The Molecular Graphics Laboratory Forum

AutoDock, AutoLigand, MGLTools, Vina, PyRx and more.
It is currently Mon May 20, 2013 4:44 am

All times are UTC




Post new topic Reply to topic  [ 4 posts ] 
Author Message
 Post subject: BuildDNA(w3DNA) problem
PostPosted: Wed Apr 25, 2012 1:58 pm 
Offline
Millimolar User
Millimolar User
User avatar

Joined: Fri Dec 16, 2011 6:51 pm
Posts: 5
I am having trouble getting this extension to work. I enter a file name, a DNA sequence and select B-DNA and click 'build'... nothing happens. The stopwatch appears for about a second and then nothing. Am I missing a step somewhere? The sequence I entered is

GCCATGATTAACGAGTGGAGT

I am not having any trouble fetching pdb files so I do not think this is a web connectivity issue.


Top
 Profile  
 
PostPosted: Wed Apr 25, 2012 3:10 pm 
Offline
Picomolar User
Picomolar User
User avatar

Joined: Wed Apr 22, 2009 2:08 am
Posts: 226
Hi,

what is your host ?
what is your OS ?

did you check the console / terminal of the host, and can you show me it.

Is the file name you enter have the extension ? namely: "myseq.pdb" ?


Ludovic


Top
 Profile  
 
PostPosted: Wed Apr 25, 2012 3:22 pm 
Offline
Millimolar User
Millimolar User
User avatar

Joined: Fri Dec 16, 2011 6:51 pm
Posts: 5
I am running Cinema 4D R13 on OSX (10.6.8). I fixed the problem by adding the .pdb extension to the file name. Thank you so much for your help!! Great extension.


Top
 Profile  
 
PostPosted: Wed Apr 25, 2012 3:40 pm 
Offline
Picomolar User
Picomolar User
User avatar

Joined: Wed Apr 22, 2009 2:08 am
Posts: 226
You should have a look to the webserver : http://w3dna.rutgers.edu/
Feel free to share your rendering !
Ludo


Top
 Profile  
 
Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 4 posts ] 

All times are UTC


Who is online

Users browsing this forum: No registered users and 2 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
POWERED_BY
Translated by MaĆ«l Soucaze © 2009 phpBB.fr